Primer-Blast results
U.S. flag

An official website of the United States government

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation
Primer-BLAST Results Help

Primer-BLAST was developed at NCBI to help users make primers that are specific to intended PCR target. It uses Primer3 to design PCR primers and then uses BLAST and global alignment algorithm to screen primers against user-selected database in order to avoid primer pairs (all combinations including forward-reverse primer pair, forward-forward as well as reverse-reverse pairs) that can cause non-specific amplifications. To cite Primer-BLAST or look for more details, please consult our publication:

Ye J, Coulouris G, Zaretskaya I, Cutcutache I, Rozen S, Madden T (2012). Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction. BMC Bioinformatics. 13:134. Use of Primer3 itself is subject to the terms and conditions stated on Primer3 web site .
Input PCR template
none
Specificity of primers
Target templates were found in selected database: Nucleotide collection (nt)
Other reports
Search Summary
Search parameters and other details
Search parameter name
Search parameter value
Number of Blast hits analyzed 171791
Entrez query
Min total mismatches 1
Min 3' end mismatches 2
Defined 3' end region length 5
Mismatch threshold to ignore targets 6
Max target size 4000
Max number of Blast target sequences 100000
Blast E value 30000
Blast word size 7
Max candidate primer pairs 500
Min PCR product size 73
Max PCR product size 3000
Min Primer size 15
Opt Primer size 20
Max Primer size 25
Min Tm 57
Opt Tm 60
Max Tm 63
Max Tm difference 3
Repeat filter AUTO
Low complexity filter Yes

Primer pair 1

Sequence (5'->3') Length Tm GC% Self complementarity Self 3' complementarity
Forward primer TTCTCCACCAACCACAAGGACATCGG 26 66.69 53.85 3.00 1.00
Reverse primer CACCTCAGGGTGTCCGAAAAACCAGAA 27 66.85 51.85 6.00 4.00